Warning: mkdir(): Permission denied in /home/virtual/lib/view_data.php on line 87 Warning: chmod() expects exactly 2 parameters, 3 given in /home/virtual/lib/view_data.php on line 88 Warning: fopen(/home/virtual/jikm/journal/upload/ip_log/ip_log_2026-04.txt): failed to open stream: No such file or directory in /home/virtual/lib/view_data.php on line 95 Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 96 만성폐쇄성폐질환 및 미세먼지 유발 폐손상 동물모델에서 과루행련환의 효과

만성폐쇄성폐질환 및 미세먼지 유발 폐손상 동물모델에서 과루행련환의 효과

Effects of Gwaruhaengryeon-hwan on COPD and Particulate Matter Induced Lung Injury on a Mouse Model

Article information

J Int Korean Med. 2017;38(3):353-366
Publication date (electronic) : 2017 June 30
doi : https://doi.org/10.22246/jikm.2017.38.3.353
이철화1, 양원경1,2, 유이란1, 김승형2, 박양춘1,2,
1 대전대학교 한의과대학 내과학교실
1 Dept. of Internal Medicine, College of Korean Medicine, Dae-Jeon University
2 대전대학교 동서생명과학연구원
2 Institute of Traditional Medicine and Bioscience, Dae-Jeon University
교신저자: 박양춘 대전광역시 서구 대덕대로 176번길 75 대전대학교 둔산한방병원 한방내과 TEL: +82-42-470-9126 FAX: +82-42-470-9486 E-mail: omdpyc@dju.kr
These authors contributed equally to this work.
Received 2017 May 31; Revised 2017 July 2; Accepted 2017 June 29.

Abstract

Objective

This study aimed to use a mouse model to evaluate the effects of Gwaruhaengryeon-hwan (GHH) on chronic obstructive pulmonary disease (COPD) and particulate matter induced lung injury.

Materials and Methods

The study was carried out in two ways (in vitro, in vivo). In vitro RAW 264.7 cells (mouse macrophage) were used and analyzed by flow cytometry, ELISA. In vivo lipopolysaccharide (LPS) and cigarette smoke solution (CSS), or coal, fly ash, diesel exhaust particle (CFD) challenged mice were used and its BALF was analyzed by ELISA, lung tissue by real-time PCR.

Results

In vitro, GHH maintained an 80-100% rate of viability. So cytotoxicity was not shown. In the ELISA analysis with RAW 264.7 cells, GHH significantly decreased NO over 30 μg/ml. In the ELISA analysis, GHH significantly decreased TNF-α, IL-6 over 300 μg/ml. In the COPD model, the GHH 200 mg/kg dosage group, the application of GHH significantly decreased the increasing of neutrophils, TNF-α, IL-17A, MIP2, CXCL-1 in BALF, TNF-α, IL-1β mRNA expression in lung tissue and histological lung injury. In the CFD induced lung injury model, the GHH 200 mg/kg dosage group, the application of GHH significantly decreased the increase of neutrophils, TNF-α, IL-17A, MIP2, CXCL-1 in BALF, MUC5AC, TGF-β mRNA expression in lung tissue and histological lung injury.

Conclusion

This study suggests the usability of GHH for COPD patients by controlling lung tissue injury.

I. 서 론

만성폐쇄성폐질환(Chronic Obstructive Pulmonary Disease, 이하 COPD)은 흡연, 직업에 따른 노출, 실내외의 공기 오염, 감염 등으로 만성 염증이 발생하고 비가역적인 기류제한이 진행되면서 발생하는 폐기능 저하로 인해 호흡곤란을 유발하는 만성질환이다1. COPD의 핵심적인 특징인 비가역적 기류제한은 오랜 시간에 걸쳐 진행되며 만성염증으로 인한 기도 섬유화와 같은 소기도 협착과 폐포 파괴로 인한 탄성반도압의 감소로 호기 시 기도가 좁아지거나 열리지 않음으로써 발생한다2. 이러한 변화는 COPD 환자가 장기간에 걸쳐 흡입한 유해 기체나 입자들에 대한 폐의 염증반응에 의해 유발되며 이중에서도 특히 흡연이 가장 중요한 위험인자로 알려져 있다3. COPD의 자연경과에 악영향을 주는 급성악화는 COPD 환자의 호흡기증상이 매일의 일상적인 변동범위를 넘어 치료하고 있는 약제를 변경해야 할 정도로 급격히 악화된 상태로 정의된다4. 급성악화의 원인은 기도감염이 가장 흔한 원인이나 대기오염의 중요성도 점차 부각되고 있으며5, 특히 미세먼지가 COPD의 발생과 악화에서 중요한 역할을 하는 것으로 주목되고 있다6. 미세먼지는 공기 중의 총 부유분진 중 직경 10 μm 이하의 먼지(PM10, particulate matter less than 10 μm in diameter)를 말한다7. 미세먼지는 흡입이 가능한 정도의 크기로 기관지의 하부 및 폐 실질에 도달하여 침착됨으로써 호흡기계에 손상을 일으킬 수 있으며 증상악화와 유병률 및 사망률을 증가시킬 수 있다8.

COPD를 폐기종과 만성기관지염으로 구분되는 질환이 아닌 하나의 독립된 병태생리학적 개념으로 파악하게 되면서 한의학에서도 이에 맞추어 COPD의 새로운 변증유형 분류로서 風寒型, 痰濁型, 肺熱型, 肺虛型, 脾虛型, 腎陽虛型, 腎陰虛型의 7가지 범주가 제시되었다9. COPD에 대한 한방치료 효과를 평가한 기존의 연구로는 風寒型의 소청룡탕10,11, 肺虛型의 맥문동탕12과 생맥청폐음13, 肺陰虛型의 청상보하탕에서 유래한 PM01414, 痰濁型의 사간탕15에 대한 연구가 있었으나 肺熱型에 대한 연구는 없었다. 과루행련환(瓜蔞杏連丸)은 ≪동의보감(東醫寶鑑)≫16의 해수(咳嗽)문에 기재된 주수(酒嗽)에 사용하는 처방으로 과루인, 행인, 황련으로 구성되어 있으며 대전대학교 부속한방병원 폐계내과에서 肺熱型COPD의 기본처방으로 활용되고 있다.

본 연구에서는 COPD에 대한 과루행련환의 효과를 평가하기 위하여 RAW 264.7 세포를 이용한 MTT assay를 통해 세포독성을 분석하였고, ELISA (enzyme-linked immunosorbent assay)를 통해 항염증 반응을 평가하였다. 또한 LPS(lipopolysaccharide)와 표준담배 추출물(Cigarette Smoke Solution, CSS)로 유발한 COPD 동물모델17과 실험적 미세먼지(Coal, fly ash, and diesel exhaust particle, CFD)로 유발한 폐손상 동물모델18을 이용하여 ELISA를 통하여 염증 cytokine 생성수준을 분석하였으며, real-time PCR(polymerase chain reaction)을 통해 연관 유전자의 발현정도를 평가하였고, lung biopsy로 폐조직 손상에 대한 작용을 확인하였다. 본 실험결과 염증 cytokine 및 관련 유전자 발현을 억제하고 폐조직 손상을 감소시키는 과루행련환의 효과를 확인하였다.

II. 재료 및 방법

1. 재 료

과루행련환(Gwaruhaengryeon-hwan, GHH)의 구성 약물은 ㈜휴먼허브(Gyeongbuk, Korea)에서 지원받았다. 환류추출을 통하여 얻은 액을 여과하여, 감압 증류장치(Buchi B-480, Switzerland)를 이용하여 농축한 후, 동결 건조 후 추출물을 수득하였다. 13.72%, 과루인, 행인, 황련은 각각 4.23, 17.15, 22.06%의 수율을 나타냈다.

2. 방 법

1) In vitro실험

(1) RAW 264.7 세포

In vitro실험에 사용한 mouse macrophage인 RAW 264.7세포는 한국세포주은행(Seoul, Korea)에서 분양받아 사용하였으며, DMEM(Dulbecco’s Modified Eagle Medium)배지를 사용하였다.

(2) 세포 독성

과루행련환과 구성 약물로서 과루인, 행인, 황련의 세포를 대상으로 하는 독성 측정은 MTT(3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide, Sigma, USA) 측정으로 분석하였다. 과루행련환과 과루인, 행인, 황련 추출물을 농도별(10, 30, 50, 100, 300 및 500 μg/ml)로 24시간 동안 처리하였다. microplate reader(VERSAmax, Molecular Devices, USA)를 사용하여 570 nm에서 흡광도를 측정하여 대조군에 대한 백분율로 세포생존율을 표시하였다.

(3) 항염증 분석

Nitric oxide(NO)의 발현에 대한 영향을 측정하기 위하여 ELISA를 수행하였다. 또한 TNF-α, IL-6의 발현에 미치는 영향을 측정하였다. 전처리로 각 농도(10, 30, 50, 100, 300 및 500 μg/ml)의 과루행련환과 과루행련환 구성약물 추출물을 24시간 동안 LPS(400 ng/ml)를 처리하고, 반응을 종결시킨 후 450 nm에서 흡광도를 측정하였다.

2) COPD 및 미세먼지 폐손상 동물모델 실험

(1) 동 물

실험에 사용한 동물은 BALB/c 계열의 7주령 수컷 생쥐(대한바이오링크, Korea)로서 물과 고형 사료를 제약 없이 섭취하도록 하였으며, 22-24 °C의 온도와 50±10%의 습도가 유지되고, 밤낮 주기가 조절되는 조명을 갖춘 실험실 환경에서 사육하였다. 본 실험은 대전대학교 동물실험윤리위원회가 정한 규정에 따라 시행되었다(승인번호: DJUARB2016-008, DJUARB2016-009).

(2) CSS 및 CFD의 제조

① 표준담배 연기의 포집 및 응축물 추출

표준담배 Coresta Monitering Cigarette 7(CM7, Heinr Borgwaldt, Germany)의 연기응축물 포집은 ISO3402 규정에 따라 실시하였으며, ISO3308 규정에 따라 자동흡연장치(RM20/CS, Heinr Borgwaldt, Germany)를 사용하여 35.0±0.3 ml의 흡연부피, 60±0.5초의 흡연주기, 2.00±0.02초의 흡연시간, tip paper 길이+3 mm(overwrap+3 mm)의 꽁초길이를 조건으로 하여 ISO 표준 흡연 방법으로 궐련담배를 연소시키고, 92 mm cambridge filter(ISO3308 규격품, USA)로 담배연기응축물을 포집하였다. Cigarette holder(RM20, Heinr Borgwaldt, Germany)에서 담배연기응축물이 포집된 cambridge filter를 분리한 다음, 실온 상태에서 8시간 이상을 방치하여 추출하였다. Fig. 1의 공식에 따라 표준담배 주류연(主流煙)에서 Total Particulate Matter(TPM)의 함량을 계산하였다.

Fig. 1

Total particulate matter (TMC) of cigarette smoke solution.

N : cigarette number of each trap, WFHA : weight of filter holder after smoke, WFHB : weight of filter holder before smoke

② 미세먼지 폐손상 유도물질 제작

미세먼지 폐손상 동물실험의 유도물질로서 석탄연소물(coal), 비산재(fly ash), 디젤 배출입자(Diesel exhaust particle, DEP)로 구성된 실험적 미세먼지(coal, fly ash, DEP, CFD)는 ㈜KT&G 중앙실험실에서 공급받아 사용하였다.

(3) COPD 및 미세먼지 폐손상 모델

① COPD 모델

7주령의 BALB/c 수컷 생쥐를 대상으로 LPS와 표준담배 추출물(Cigarette smoking solution, CSS)을 주 1회 간격으로 3주간 흡인시켜 COPD를 유발시켰다. Dexamethasone(3 mg/kg)을 투여한 양성대조군(Positive control), 실험약물을 투여하는 각각의 실험군은 2주간 매일 경구로 투여 하였다.

② 미세먼지 폐손상 모델

미세먼지는 여러 가지 복합 성분을 함유한 대기 중 부유 물질로서, 그 중 미세먼지의 구성성분인 Coal(석탄 탄소물), Fly ash(화력발전소 등의 연소보일러에서 부산되는 석탄재), DEP(디젤연소분진)을 혼합하여 미세먼지 혼합물을 제작하였다. DMSO에 녹인 Coal, Fly ash, DEP stock을 Alum(Aluminium Hydrocide Gel Adjuvant)으로 희석되게 하여 최종적으로 미세먼지 혼합물을 제작하였다. CFD의 투여는 7주령 BALB/c 수컷 생쥐를 대상으로 기도로 흡인시켰다. 실험군은 정상군(Normal), 약물을 투여하는 각각의 실험군은 10일간 매일 경구로 투여 하였다.

(4) Enzyme-Linked Immunosorbent Assay(ELISA)

BALF 내의 IL-17A, TNF-α, MIP2, CXCL-1의 양을 측정하기 위해 ELISA를 수행하였다. 각 capture antibody를 각각의 well에 coating하고, Well당 assay diluent를 넣고, blocking을 한 다음, 실험군을 반응시켰다. Detection antibody 반응을 거친 후, streptavidin- HRP solution을 처리하여 실온에서 반응시키고, 각각 substrate solution을 처리하여 반응시킨 다음, stop solution 을 처리하여 반응을 종결시킨 후 450 nm에서 흡광도를 측정하였다.

(5) Real-time Polymerase chain reaction(PCR) 분석

폐조직(lung tissue)에서 TNF-α, IL-1β, TGF-β, MUC5AC mRNA 발현을 측정하기 위해 real-time PCR을 수행하였다. Applied Biosystems 7500 real-time PCR system(Applied Biosystems, USA)를 이용하여 합성한 cDNA의 real-time PCR을 수행하였다. 대조군은 glyceraldehyde-3-phosphate dehydrogenase (G3PDH) probe(Applied Biosystems, USA)를 사용하였다. Probe의 sequence와 primer는 Table 1에 기재하였다. 과루행련환 투여군과 대조군의 internal standard로는 G3PDH를 사용하였으며 RQ(relative quantitative)의 측정은 target group의 Quantitative PCRy=x(1+e)n, x=starting quantity, y=yield n=number of cycles e=efficiency로 계산하였다.

Sequence of Mouse Real-time PCR Oligonucleotide

(6) Hematoxylin &Eosin 염색

폐손상의 정도를 측정하기 위하여 폐조직을 formalin에 고정 시킨 후 파라핀에 포매하여 block을 제작한 다음 hematoxylin &eosin(H&E) 염색에 사용하였다. cover-slide를 영구 부착하여 광학현미경(Light microscope, Nikon, Japan)으로 200배율에서 관찰하였다.

3) 통계분석

각 실험군의 수치 데이터 비교는 SPSS software (version 12.0, SPSS Inc., USA)를 사용하여 독립표본 T검정을 이용하여 분석하였다. p 값은 0.05, 0.01 및 0.001보다 작은 경우로 구분하였으며 이를 통계적으로 유의한 것으로 판정하였다.

III. 결 과

1. In vitro

1) 세포독성

생쥐의 macrophage인 RAW 264.7 세포에 과루행련환과 구성 약물 각각을 10 μg/ml~500 μg/ml 농도범위로 처리하여 세포생존을 평가한 결과, 각 실험군들은 정상군과 비교하여 생존율을 유지하여 세포독성을 나타내지 않았다(Fig. 2A).

Fig. 2

Cytotoxicity of GHH on proliferation (A) and NO production (B) of RAW 264.7 cell.

RAW 264.7 cells were treated with various concentrations of GHH (TF : Trichosanthis Fructus, AS : Armeniacaeamarum Semen, CR : Coptidis Rhizoma) for 24 hr, and harvested for MTT assay. One-way ANOVA test. †: Significantly different from the non-treated group (†††p<0.001) * : Significantly different from the control group (** p<0.01).

2) NO 생성에 미치는 영향

LPS로 유도된 대조군의 NO는 70.47±9.42 μM로 나타나 정상군의 1.63±0.56 μM보다 유의하게 증가하였다. 대조군에 비해 과루인과 황련, 과루행련환 투여한 실험군에서 모두 유의성 있게 감소시켰다(Fig. 2B).

3) TNF-α, IL-6 생성에 미치는 영향

LPS로 유도된 대조군의 TNF-α, IL-6는 정상군보다 유의하게 증가하였고, 양성대조군과 실험군에서는 유의하게 감소시켰다(Fig. 3).

Fig. 3

Effects of GHH on TNF-α (A) and IL-6 (B) production of LPS induced RAW 264.7 cells.

RAW 264.7 cells were administrated LPS (Control, 400 ng/ml), and then treated with Trichosanthis Fructus (TF), Armeniacaeamarum Semen (AS), CoptidisRhizoma (CR) and GHH. One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001) * : Significantly different fromthe Control group (* p<0.05, ** p<0.01, *** p<0.001).

2. COPD 동물모델에 대한 영향

1) BALF 내 cytokine 생성에 미치는 영향

COPD를 유발한 대조군의 TNF-α는 307.52±33.64 pg/ml로 나타나 정상군보다 유의하게 증가하였으며, COPD를 유발한 다음 dexamethasone을 처리한 양성대조군, 과루인, 행인, 황련 및 과루행련환을 투여한 실험군에서 대조군에 비하여 유의한 감소를 보였다(Fig. 4A). 대조군의 IL-17A는 정상군보다 유의한 증가를 보였으며, 양성대조군, 과루인, 행인, 황련, 과루행련환을 투여한 실험군에서 대조군에 비하여 유의한 감소를보였다(Fig. 4B). CXCL-1, MIP2 또한 dexamethasone군과 과루인, 행인, 황련, 과루행련환을 투여한 실험군에서 대조군에 비하여 유의한 감소를 보였다(Fig. 4C, 4D).

Fig. 4

Effect of GHH on TNF-α (A), IL-17A (B), MIP2 (C) and CXCL-1 (D) production of BALF in COPD mice.

Mice were challenged by aspiration of LPS+CSS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 21 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††p<0.01, †††p<0.001), * : Significantly different from the Control group (* p<0.05, ** p<0.01, *** p<0.001).

2) 폐조직 내 관련 단백질 mRNA 발현에 미치는 영향

대조군의 TNF alpha mRNA Relative Quantitive (RQ)는 정상군보다 증가하였으며, dexamethasone을 처리한 양성대조군은 1.36±0.52, 과루인, 황련, 행인, 과루행련환을 투여한 실험군에서 대조군에 비하여 유의한 감소를 보였다(Fig. 5A). COPD를 유발한 대조군의 IL-1beta mRNA Relative Quantitive (RQ)는 또한, 대조군에 비하여 유의한 감소를 보였다(Fig. 5B).

Fig. 5

Effect of GHH on TNF-α (A) andIL-1beta (B) mRNA expression in lung tissue in COPD mice.

Mice were challenged by aspiration of LPS+CSS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 21 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (* p<0.05, ** p<0.01, *** p<0.001).

3) 폐조직 손상에 미치는 영향

정상군의 폐조직에서는 작은 크기의 폐포가 균일하게 관찰되었으나, 대조군의 경우 폐포가 균일한 상태를 보이지 않으면서, 기도벽이 두꺼워지는 현상이 나타났으며, 폐포 주변으로 세포들이 많이 몰려있는 것이 관찰되었다. Dexamethasone을 처리한 양성대조군은 비교적 폐포의 형태가 균일하게 유지되었으며, 과루인, 행인, 황련및 과루행련환을 투여한 실험군은 폐포 주변에 세포들이 몰려있는 현상은 보였으나 대조군에 비해 상대적으로 폐포의 형태가 균일하게 유지되는 것이 관찰 되었다(Fig. 6).

Fig. 6

Effect of GHH on histophathological changes image (A) and histological analysis score (B) of lung following LPS+CSS-induced murine model of COPD.

Mice were challenged by aspiration of LPS+CSS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 21 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (* p<0.05, ** p<0.01, *** p<0.001).

3. 미세먼지 폐질환 동물모델에 대한 영향

1) BALF 내 cytokine 생성에 미치는 영향

CFD로 폐손상을 유발한 대조군의 TNF-α(Fig. 7A), IL-17A(Fig. 7B), MIP2(Fig. 7C), CXCL-1 (Fig. 7D)는 정상군보다 유의하게 증가하였으며, 양성대조군, 과루인, 행인, 황련 및 과루행련환을 투여한 실험군에서는 대조군에 비하여 유의하게 감소하였다.

Fig. 7

Effect of GHH on TNF-α (A), IL-17A (B), MIP2 (C) and CXCL-1 (D) production of BALF in CFD induced lung injury mice.

Mice were challenged by aspiration of CFD (Control), and then treated with NAC (N-acetyl-L-cysteine 2 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 10 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group(* p<0.05, ** p<0.01, *** p<0.001).

2) 폐조직내 연관 단백질 mRNA 발현에 미치는 영향

CFD로 폐손상을 유발한 대조군의 MUC5AC, TGF-β mRNA Relative Quantitive(RQ)는 정상군은 유의하게 증가하였고, 양성대조군 및 실험군에서 모두 유의하게 감소하였다(Fig. 8).

Fig. 8

Effect of GHH on MUC5AC (A) and TGF-β (B) mRNA expression in lung tissue in CFD induced lung injury mice.

Mice were challenged by aspiration of CFD (Control), and then treated with NAC (N-acetyl-L-cysteine 2 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 10 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (*** p<0.001).

3) 폐조직 손상에 미치는 영향

정상군의 조직소견에서는 정상적인 크기의 폐포가 균일한 양상으로 관찰되었으나, CFD로 폐손상을 유발시킨 대조군에서는 폐포의 크기와 형태가 균일하지 않고, 기도벽이 두꺼워지는 현상이 나타났으며, 폐포 주변에 세포들이 많이 몰려있는 것이 관찰되었다. NAC을 처리한 양성대조군은 폐포의 형태가 비교적 균일하게 유지되었으며, CFD 유발 후 과루인, 행인, 황련및 과루행련환을 투여한 실험군에서는 폐포 주변으로 세포들이 몰려있는 현상은 보였으나 대조군에 비해 폐포의 크기와 형태가 상대적으로 균일하게 유지되는 것이 관찰되었다(Fig. 9).

Fig. 9

Effect of GHH on histophathological changes image (A) and histological analysis score (B) of lung following CFD-induced lung injury mice.

Mice were challenged by aspiration of CFD (Control), and then treated with NAC (N-acetyl-L-cysteine 2 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 10 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (* p<0.05, ** p<0.01).

IV. 고 찰

COPD의 발생과 진행에 영향을 끼치는 위험인자로는 연령, 성별, 교육수준, 흡연량 등이 있으며 이 중 흡연량은 가장 중요한 위험인자로서 20갑년 이상의 흡연자가 비흡연자에 비해 COPD 유병률이 1.97배에 달하는 것으로 알려져 있다19. COPD의 병리적 변화가 일어나는 부위는 주로 근위부의 중심성 기도, 원위부의 소기도, 폐실질 및 폐혈관 등이며, 만성적인 염증에 따른 폐실질의 파괴가 특징이다2. 면역계는 담배연기 등 외부의 유해물질이 유입되면 즉각적인 반응을 보여 macrophage의 탐식작용이 활성화되고 MIP2, CXCL-1과 같은 chemokine의 화학주성으로 인해 neutrophil이 유도되며 단백분해효소 분비가 증가하여 폐실질의 파괴가 일어난다20. IL-6, TNF-α는 염증 cytokine으로 기도와 폐실질의 염증반응을 증가시키고 IL-6의 경우 Regulatory T 세포의 신호를 억제21함으로써 COPD의 염증 반응을 더욱 악화시킨다. TGF-β는 성장인자로서 IFN-γ에 의해 macrophage 혹 소기도 상피세포에서 발현되며 섬유모세포 혹 기관지 평활근 세포의 증식을 유발하고20 MUC5AC gene의 과다발현은 COPD환자에서 기도내 점액생성과다를 유발하여22 소기도 폐색을 악화시킨다. 최근 사회적 관심이 높아지고 있는 미세먼지는 COPD의 자연경과에 악영향을 주어 급성악화를 유발함으로써 COPD 환자의 입원율 및 사망률의 증가를 가져오는 것으로 알려져 있다23,24. 미세먼지에 노출되면 기관지폐포세척액에서 호중구, 대식세포, 림프구의 증가가 관찰되며 폐조직에서 호중구 침착의 증가와 기관조직에서 림프구, 비만세포, IL-8 mRNA 발현의 증가를 가져온다고 알려져 있다25.

본 실험에서 평가된 과루행련환 구성약물 각각의 효능을 살펴보면, 과루인은 性味가 寒甘하여 肺經과 胃經에 들어가 潤肺化痰, 滑腸通便하는 효능이 있고, 행인은 肺經과 大腸經에 귀경하며 性味가 溫苦微辛하여 降氣止咳平喘, 潤腸通便시키는 主藥이 되고, 황련은 心⋅肝⋅胃⋅大腸經에 귀경하며 性味가 寒苦하여 淸熱燥濕, 淸心除煩, 瀉火解毒하여26, 과루행련환은 ≪동의보감(東醫寶鑑)≫ 해수(咳嗽)문에서 酒嗽의 치료처방으로 제시1되고 있으나 潤肺化痰, 止咳平喘, 淸熱燥濕하는 약물을 바탕으로 구성되어 있어 肺熱型 만성호흡기질환의 기본처방으로도 활용되고 있다.

기존의 한약효과 연구를 위한 동물모델에서 폐손상의 유발은 LPS14,15 elastase12,13, 담배연기 흡입17 등 여러 가지 방법이 시도되어왔다. 본 실험에서는 이 등11,16 및 Balb/c mouse의 기도내에 LPS와 CSS를 흡인시켜 COPD를 유발시킴으로써 COPD의 가장 중요한 위험인자인 흡연을 고려하였고, 실험적 미세먼지(CFD)로 유발한 폐손상 동물모델19을 이용하여 미세먼지로 인한 폐손상에 대한 효과를 평가하고자 하였다. RAW 264.7 세포를 통한 세포독성 시험에서 과루행련환과 각각의 구성 약물을 10 μg/ml에서 500 μg/ml의 범위로 처리한 결과, 모든 농도에서 정상군 수준의 생존율을 유지하여 이를 세포독성을 나타내지 않는 것으로 해석하여 모든 농도를 실험농도로 설정하였다. RAW 264.7 세포에 LPS로 자극한 대조군의 NO는 유의하게 증가하였고, 과루행련환은 저농도에서부터 농도의존적으로 유의성 있게 감소시켰다(Fig. 2). 이러한 결과는 과루행련환이 NO 억제에 있어 개별 약물의 조합에 따른 상승효과를 반영하는 것으로 보이며 폐포대식세포가 담배연기로 인해 세포질 내외로 산화물질을 유리시켜 산화스트레스를 증가시킨다는 연구27결과를 참고할 때, 과루행련환이 산화스트레스로 인한 폐조직의 손상과 이에 대한 복구장애로 폐기종이 발생하는 병리적 변화를 감소시킬 수 있을 것으로 사료된다. ELISA 분석에서 LPS로 자극한 대조군의 TNF-α, IL-6는 과루인, 행인, 황련 및 과루행련환이 농도의존적으로 TNF-α와 IL-6를 감소시켜(Fig. 3) 산화물질의 분비억제와 더불어 염증 cytokine 억제효과를 나타냄으로써 전반적인 염증 조절작용을 가질 것으로 기대되었다. COPD 유발 마우스 모델 BALF에서의 대조군neutrophil 증가는 기존의 실험들11,16과도 일치하는 결과로 흡연자 및 COPD 환자에서 활성화된 neutrophil 증가가 나타나는 것으로 알려져 있다28. COPD를 유발 동물모델 BALF의 ELISA 분석에서 대조군의 TNF-α와 IL-17A는 정상군보다 유의하게 증가하였으며, 과루행련환과 구성약물을 투여한 실험군에서는 대조군에 비하여 유의한 감소를 보였다(Fig. 4). TNF-α는 COPD 환자의 객담에서 증가되어 있고29, 악액질을 동반한 COPD 환자의 혈청에서도 증가 양상을 보이며30, 장기 흡연자의 말초기도에서 neutrophil이 축적되는데 기여하는 것으로 알려져 있다31. 따라서 과루행련환과 과루행련환 구성약물들이 이와 같이 염증 cytokine들을 감소시킴으로써 neutrophil이 관련되는 염증에 억제효과를 나타내는 것으로 생각된다. COPD 유발 동물모델 BALF의 ELISA 분석에서 CXCL-1, MIP2는 정상군보다 유의한 증가를 보였으며, 행인, 황련 및 과루행련환을 투여한 실험군에서 대조군에 비하여 유의한 감소를 보였다(Fig. 4). CXCL-1는 COPD 환자의 객담에서 증가한다고 알려져 있고32 CXCL-1, MIP2는 chemokine으로서 주로 macrophage로부터 분비되어 neutrophil 등 염증관련 세포들이 병소로 모이도록 하는 역할을 하는 것으로 보고되고 있어33 이러한 결과는 과루행련환과 구성약물들이 이들 chemokine의 발현을 억제시킴으로써 염증관련 세포가 기도내로 유입되는 것을 억제할 가능성이 있음을 시사한다. COPD 유발 동물모델 폐조직의 real-time PCR 분석에서 TNF-α 및 IL-1β mRNA RQ는실험군에서 대조군에 비하여 유의한 감소를 보였다(Fig. 5). 과루행련환과 구성약물의 이러한 억제 작용은 macrophage 활성 억제를 통하여 COPD 염증을 조절할 수 있을 가능성을 제시한다고 생각된다. COPD 유발 동물모델 폐조직 생검과 현미경 관찰에서 정상군은 작은 크기의 폐포가 균일하게 관찰되었으며, 대조군에서는 폐포의 형태가 균일하지 않고, 기도벽이 비후되어 있으며, 폐포 주변의 염증세포가 다수 관찰되었다. 양성대조군, 과루행련환 및 구성약물을 투여한 실험군에서는 염증세포의 감소가 관찰되었고 폐포의 크기와 형태가 비교적 균일하게 유지되고 있음을 관찰할 수 있어(Fig. 6) 과루행련환과 각 구성약물이 폐조직 손상을 보호하는 효과를 나타냄을 확인할 수 있었다. 실험적 미세먼지로 유발한 폐손상 모델에서도 폐조직의 real-time PCR 분석에서 대조군에서 증가를 나타낸 MUC5AC 및 TGF-β mRNA의 발현을 억제하는 결과를 보였다(Fig. 8). MUC5AC는 주로 TNF-α에 의해 발현이 유도되는데 기도 상피세포에 작용하여 mucin의 분비를 증가시키는데34,35 과루행련환 투여가 MUC5AC mRNA 발현을 감소시킴으로써 상피세포에서의 점액 분비를 감소시키고 TGF-β mRNA 발현을 감소시킴으로써 기도벽의 비후를 억제시켜 소기도 폐색을 감소시키는 효과를 보일 것으로 사료되었다. 이러한 결과는 과루행련환이 담배연기 또는 대기오염으로 발생하는 만성폐손상에 모두 활용될 수 있음을 시사하는 것으로 생각된다. 과루행련환이 산화물질을 감소시키고 macrophage의 TNF-α 및 IL-6 분비를 억제하는 효과가 관찰되었고, in vivo 실험에서는 과루행련환이 COPD 동물모델 및 미세먼지 유발 폐손상모델에서 BALF내 neutrophil을 감소시키고 관련 cytokines 및 단백질의 mRNA 발현을 억제하며 폐조직 손상을 보호하는 효과가 있음을 확인할 수 있었다. 또한 복합제로서의 과루행련환과 과루행련환 구성약물들에서 나타나는 결과를 비교하면 각각의 약물들이 작용하는 부문에서 차이를 보이고 있어 효과적인 처방구성을 찾기 위한 다양한 연구가 필요할 것으로 생각된다. neutrophil 및 염증 cytokine의 증가를 억제하고 폐조직의 손상을 감소시키는 폐손상 보호효과를 통하여 COPD와 미세먼지로 인한 폐질환에 대한 치료에 효과를 나타낼 것으로 사료된다.

감사의 글

본 연구는 교육부의 재원으로 한국연구재단의 기초연구사업(과제번호: NRF-2015R1D1A1A01058852)과 한국한의학연구원(과제코드: K17513)의 지원을 받아 수행되었음.

References

1. Global Initiative for Chronic Obstructive Lung Disease. Global Strategy for Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary Disease 2017 Report Available from: http://www.goldcopd.org. Accessed Nov 11 2016.
2. Yoo CG. Pathogenesis and pathophysiology of COPD. Korean J Intern Med 2009;77(4):383–400.
3. Pelkonen M. Smoking:relationship to chronic bronchitis, chronic obstructive pulmonary disease and mortality. CurrOpinPulm Med 2008;14(2):105–9.
4. Rodriguez-Roisin R. Toward a consensus definition for COPD exacerbations. Chest 2000;117:398S–401S.
5. Sint T, Donohue JF, Ghio AJ. Ambient air pollution particles and the acute exacerbation of chronic obstructive pulmonary disease. InhalToxicol 2008;20(1):25–9.
6. Ling SH, van Eeden SF. Particulate matter air pollution exposure:role in the development and exacerbation of chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis 2009;4:233–43.
7. World Health Organization. Air pollution including WHO’s 1999 guidelines for air pollution control Geneva: World Health Organization; 2000.
8. Pope CA, Ezzati M, Dockery DW. Fine-particulate air pollution and life expectancy in the United States. N Engl J Med 2009;360:376–86.
9. Lee BJ, Jung HJ, Choi JY, Kang W, Jung SK. Preliminary study to develop a Korean oriental medicine assessment tool for syndrome differentiation of chronic obstructive pulmonary disease. J Korean Oriental Med 2012;33(3):82–94.
10. Lee ES, Han JM, Kim MH, Namgung U, Yeo Y, Park YC. Effects of inhalable microparticles of Socheongryong-tang on chronic obstructive pulmonary disease in a mouse model. J Korean Med 2013;34(3):54–68.
11. Lee JG, Yang SY, Kim MH, Namgung U, Park YC. Protective effects of Socheongryong-tang on elastase-induced lung injury. J Korean Oriental Med 2011;32(4):83–99.
12. Kim HW, Yang SY, Kim MH, Namgung U, Park YC. Protective effects of Maekmundong-tang on elastase-induced lung injury. J Korean Oriental Med 2011;32(2):63–78.
13. Kim Y, Yang SY, Kim MH, Namgung U, Park YC. Effects of Saengmaekcheongpye-eum on LPS-induced COPD model. Korean J Oriental Int Med 2011;32(2):217–31.
14. Lee H, Kim Y, Kim HJ, Park S, Jang YP, Jung S, et al. Herbal Formula, PM014, Attenuates Lung Inflammation in a Murine Model of Chronic Obstructive Pulmonary Disease. Evid Based Complement Alternat Med 2012;2012:769830.
15. Han JM, Yang WK, Kim SH, Park YC. Effects of Sagan-tang and individual herbs on COPD mice model. J Korean Med Soc Herb Formula Study 2015;23(2):171–87.
16. Hur J. Dong-Eui-Bo-Gam Seoul: Namsandang; 1986. p. 473.
17. Food and Drug Administration. Revision of the Guidelines for Measures for Hazard component of inhibitor of smoking desire Available at: http://www.mfds.go.kr. Accessed Nov 1 2014.
18. Kim SH, Park YC, Lee JE, Yang WK, Choi JJ, Oh JG. Method for preparing mouse model induced ambient particulate matter. Korea Patent 10-2016-0156279, Nov. 23 2016;
19. Jung YM, Lee HY. Chronic Obstructive Pulmonary Disease in Korea:Prevalence, Risk Factors, and Quality of Life. J Korean Acad Nurs 2011;41(2):149–56.
20. Barnes PJ. The cytokine network in asthma and chronic obstructive pulmonary disease. J Clin Invest 2008;118(11):3546–56.
21. Lambrecht BN, Prins JB, Hoogsteden HC. Lung dendritic cells and host immunity to infection. Eur Respir J 2001;18(4):692–704.
22. Wang G, Xu Z, Wang R, Al-Hijji M, Salit J, Strulovici-Barel Y, et al. Genes associated with MUC5AC expression in small airway epithelium of human smokers and nonsmokers. BMC Med Genomics 2012;5:21.
23. Chen L, Yang W, Jennison BL, Omaye ST. Air particulate pollution and hospital admissions for chronic obstructive pul-monary disease in Reno, Nevada. Inhal Toxicol 2000;12(4):281–98.
24. Sunyer J, Basagana X. Particles, and not gases, are associated with the risk of death in patients with chronic obstructive pulmonary disease. Int J Epidemiol 2001;30(5):1138–40.
25. McCreanor J, Cullinan P, Nieuwenhuijsen MJ, Stewart-Evans J, Malliarou E, Jarup L, et al. Respiratory effects of exposure to diesel traffic in persons with asthma. N Engl J Med 2007;357(23):2348–58.
26. Gang BS, Kim IR, Kim HC, Guk YB, Park YG, Seo BI, et al. Bonchohak Seoul: Younglimsa; 2006. p. 180–1. 461-2, 478-9.
27. Schaberg T, Haller H, Rau M, Kaiser D, Fassbender M, Lode H. Superoxide anion release induced by platelet-activating factor is increased in human alveolar macrophages from smokers. Eur Respir J 1992;5(4):387–93.
28. Keatings VM, Collins PD, Scott DM, Barnes PJ. Differences in interleukin-8 and tumor necrosis factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Respir Crit Care Med 1996;153(2):530–4.
29. Aaron SD, Angel JB, Lunau M, Wright K, Fex C, Le Saux N, et al. Granulocyte inflammatory markers and airway infection during acute exacerbation of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001;163(2):349–55.
30. Deveci Y, Deveci F, Ilhan N, Karaca I, Turgut T, Muz MH. Serum ghrelin, IL-6 and TNF-αlevels in patients with chronic obstructive pulmonary disease. Tuberk Toraks 2010;58(2):162–72.
31. Levänen B, Glader P, Dahlén B, Billing B, Qvarfordt I, Palmberg L, et al. Impact of tobacco smoking on cytokine signaling via interleukin-17A in the peripheral airways. Int J Chron Obstruct Pulmon Dis 2016;11:2109–16.
32. Lukacs NW, Hogaboam CM, Kunkel SL. Chemokines and their receptors in chronic pulmonary disease. Curr Drug Targets Inflamm Allergy 2005;4(3):313–7.
33. Traves SL, Culpitt SV, Russell RE, Barnes PJ, Donnelly LE. Increased levels of the chemokines GROαand MCP-1 in sputum samples from patients with COPD. Thorax 2002;57(7):590–5.
34. Guzman K, Gray TE, Yoon JH, Nettesheim P. Quantitation of mucin RNA by PCR reveals induction of both MUC2 and MUC5AC mRNA levels by retinoids. Am J Physiol 1996;271(6 Pt 1):1023–8.
35. Borchers MT, Carty MP, Leikauf GD. Regulation of human airway mucins by acrolein and inflammatory mediators. Am J Physiol 1999;276(4 Pt 1):549–55.

Article information Continued

Fig. 1

Total particulate matter (TMC) of cigarette smoke solution.

N : cigarette number of each trap, WFHA : weight of filter holder after smoke, WFHB : weight of filter holder before smoke

Table 1

Sequence of Mouse Real-time PCR Oligonucleotide

Gene Primer     Sequence
TGF-β1 Forward 5’ CCCGAACTGTGACTTTTGCT 3’
Reverse 5’ CCTCTGGATAGCGAGGACTG 3’

MUC5AC Forward 5’ AGAATATCTTTCAGGACCCCTGCT 3’
Reverse 5’ ACACCAGTGCTGAGCATACTTTT 3’

TNF-α FAM 5’-CACGTCGTAGCAAACCACCAAGTGGA-3’

IL-1β Forward 5’-CACCTTCTTTTCCTTCATCTT-3’
Reverse 5’-GTCGTTGCTTGTCTCTCCTTGTA-3’

G3PDH VIC 5’-TGCATCCTGCACCACCAACTGCTTAG-3’

Fig. 2

Cytotoxicity of GHH on proliferation (A) and NO production (B) of RAW 264.7 cell.

RAW 264.7 cells were treated with various concentrations of GHH (TF : Trichosanthis Fructus, AS : Armeniacaeamarum Semen, CR : Coptidis Rhizoma) for 24 hr, and harvested for MTT assay. One-way ANOVA test. †: Significantly different from the non-treated group (†††p<0.001) * : Significantly different from the control group (** p<0.01).

Fig. 3

Effects of GHH on TNF-α (A) and IL-6 (B) production of LPS induced RAW 264.7 cells.

RAW 264.7 cells were administrated LPS (Control, 400 ng/ml), and then treated with Trichosanthis Fructus (TF), Armeniacaeamarum Semen (AS), CoptidisRhizoma (CR) and GHH. One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001) * : Significantly different fromthe Control group (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 4

Effect of GHH on TNF-α (A), IL-17A (B), MIP2 (C) and CXCL-1 (D) production of BALF in COPD mice.

Mice were challenged by aspiration of LPS+CSS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 21 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††p<0.01, †††p<0.001), * : Significantly different from the Control group (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 5

Effect of GHH on TNF-α (A) andIL-1beta (B) mRNA expression in lung tissue in COPD mice.

Mice were challenged by aspiration of LPS+CSS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 21 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 6

Effect of GHH on histophathological changes image (A) and histological analysis score (B) of lung following LPS+CSS-induced murine model of COPD.

Mice were challenged by aspiration of LPS+CSS (Control), and then treated with Dexa (dexamethasone 3 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 21 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (* p<0.05, ** p<0.01, *** p<0.001).

Fig. 7

Effect of GHH on TNF-α (A), IL-17A (B), MIP2 (C) and CXCL-1 (D) production of BALF in CFD induced lung injury mice.

Mice were challenged by aspiration of CFD (Control), and then treated with NAC (N-acetyl-L-cysteine 2 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 10 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group(* p<0.05, ** p<0.01, *** p<0.001).

Fig. 8

Effect of GHH on MUC5AC (A) and TGF-β (B) mRNA expression in lung tissue in CFD induced lung injury mice.

Mice were challenged by aspiration of CFD (Control), and then treated with NAC (N-acetyl-L-cysteine 2 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 10 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (*** p<0.001).

Fig. 9

Effect of GHH on histophathological changes image (A) and histological analysis score (B) of lung following CFD-induced lung injury mice.

Mice were challenged by aspiration of CFD (Control), and then treated with NAC (N-acetyl-L-cysteine 2 mg/kg), TF (Trichosanthis Fructus 200 mg/kg), AS (Armeniacaeamarum Semen 200 mg/kg), CR (Coptidis Rhizoma 200 mg/kg) and GHH (200 mg/kg) for 10 days (n=4). One-way ANOVA test. † : Significantly different from the non-treated group (††† p<0.001), * : Significantly different from the control group (* p<0.05, ** p<0.01).